View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5848-29 (Length: 127)
Name: Solexa-NF5848-29
Description: NF5848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5848-29 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 120; Significance: 8e-62; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 120; E-Value: 8e-62
Query Start/End: Original strand, 8 - 127
Target Start/End: Complemental strand, 48694748 - 48694629
Alignment:
| Q |
8 |
acaggttctacataaatcaagaatgtctttgatccaaatagttctgtctcaaaagtgatttccctttttgcaggcaatcctttttccaaaacttccctct |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48694748 |
acaggttctacataaatcaagaatgtctttgatccaaatagttctgtctcaaaagtgatttccctttttgcaggcaatcctttttccaaaacttccctct |
48694649 |
T |
|
| Q |
108 |
taaaatcttggttctcctta |
127 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
48694648 |
taaaatcttggttctcctta |
48694629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 62; Significance: 3e-27; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 62; E-Value: 3e-27
Query Start/End: Original strand, 8 - 117
Target Start/End: Original strand, 3455598 - 3455707
Alignment:
| Q |
8 |
acaggttctacataaatcaagaatgtctttgatccaaatagttctgtctcaaaagtgatttccctttttgcaggcaatcctttttccaaaacttccctct |
107 |
Q |
| |
|
|||||||||||||| ||||| |||||||| ||||||||||||||||||||||||| |||||| |||||||||| | |||||| |||| ||||| |||| |
|
|
| T |
3455598 |
acaggttctacatatatcaaaaatgtcttaaatccaaatagttctgtctcaaaagttatttccttttttgcaggtactcctttctccattacttctctct |
3455697 |
T |
|
| Q |
108 |
taaaatcttg |
117 |
Q |
| |
|
|||||||||| |
|
|
| T |
3455698 |
taaaatcttg |
3455707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 62; E-Value: 3e-27
Query Start/End: Original strand, 8 - 117
Target Start/End: Original strand, 3480200 - 3480309
Alignment:
| Q |
8 |
acaggttctacataaatcaagaatgtctttgatccaaatagttctgtctcaaaagtgatttccctttttgcaggcaatcctttttccaaaacttccctct |
107 |
Q |
| |
|
||||||||| |||| | ||| |||||||||||||||| |||||||||||||||||| ||||||||||||||||| | |||||| |||| ||||| |||| |
|
|
| T |
3480200 |
acaggttctgcatacaacaaaaatgtctttgatccaagtagttctgtctcaaaagttatttccctttttgcaggtactcctttctccattacttctctct |
3480299 |
T |
|
| Q |
108 |
taaaatcttg |
117 |
Q |
| |
|
|||||||||| |
|
|
| T |
3480300 |
taaaatcttg |
3480309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University