View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5848-31 (Length: 127)
Name: Solexa-NF5848-31
Description: NF5848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5848-31 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 89; Significance: 2e-43; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 89; E-Value: 2e-43
Query Start/End: Original strand, 14 - 122
Target Start/End: Complemental strand, 24693651 - 24693543
Alignment:
| Q |
14 |
tcatccctaaagttgaacaatggctctaaaagaaaattctgctttgcacctttagccacaaagctgattggatggtattgccttaatcctttcccggaaa |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||| | |||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
24693651 |
tcatccctaaagttgaacaatggctctaaaagaaaattctggtttcctcctttagccacaaagctgataggatggtattgccttaatcctttcccggaaa |
24693552 |
T |
|
| Q |
114 |
tgaaacttg |
122 |
Q |
| |
|
|||||||| |
|
|
| T |
24693551 |
cgaaacttg |
24693543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 86; E-Value: 2e-41
Query Start/End: Original strand, 7 - 124
Target Start/End: Complemental strand, 24748275 - 24748158
Alignment:
| Q |
7 |
atagttctcatccctaaagttgaacaatggctctaaaagaaaattctgctttgcacctttagccacaaagctgattggatggtattgccttaatcctttc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||| ||||| |||||||||| ||| ||| | |||||||||||||||||||||||| |
|
|
| T |
24748275 |
atagttctcatccctaaagttgaacaatggctctaaaataaaattctggtttgctcctttagccaaaaaactggtaggatggtattgccttaatcctttc |
24748176 |
T |
|
| Q |
107 |
ccggaaatgaaacttgtt |
124 |
Q |
| |
|
||||||| |||||||||| |
|
|
| T |
24748175 |
ccggaaacgaaacttgtt |
24748158 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 81; E-Value: 1e-38
Query Start/End: Original strand, 13 - 113
Target Start/End: Complemental strand, 24733101 - 24733001
Alignment:
| Q |
13 |
ctcatccctaaagttgaacaatggctctaaaagaaaattctgctttgcacctttagccacaaagctgattggatggtattgccttaatcctttcccggaa |
112 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| ||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
24733101 |
ctcatccctaaagttgaacaatgggtctaaaagaaaattctggtttgcacctttagcaacaaagctgataggatggtattgccttaatcctttgccggaa |
24733002 |
T |
|
| Q |
113 |
a |
113 |
Q |
| |
|
| |
|
|
| T |
24733001 |
a |
24733001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 79; E-Value: 2e-37
Query Start/End: Original strand, 7 - 113
Target Start/End: Complemental strand, 24724395 - 24724289
Alignment:
| Q |
7 |
atagttctcatccctaaagttgaacaatggctctaaaagaaaattctgctttgcacctttagccacaaagctgattggatggtattgccttaatcctttc |
106 |
Q |
| |
|
||||| ||||||||| |||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
24724395 |
atagtgctcatccctgaagttgaacagtggctctaaaagaaaattctgatttgcacctttagccacaaagctgataggattgtattgccttaatcctttc |
24724296 |
T |
|
| Q |
107 |
ccggaaa |
113 |
Q |
| |
|
|| |||| |
|
|
| T |
24724295 |
cctgaaa |
24724289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 28; E-Value: 0.0000006
Query Start/End: Original strand, 23 - 81
Target Start/End: Complemental strand, 24706858 - 24706799
Alignment:
| Q |
23 |
aagttgaacaatggctctaaaa-gaaaattctgctttgcacctttagccacaaagctgat |
81 |
Q |
| |
|
||||| |||||||||||||||| ||||||| || ||| | ||||||||||||||| |||| |
|
|
| T |
24706858 |
aagttaaacaatggctctaaaaagaaaattatggtttcctcctttagccacaaagttgat |
24706799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University