View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5848-37 (Length: 125)
Name: Solexa-NF5848-37
Description: NF5848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5848-37 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 97; Significance: 4e-48; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 97; E-Value: 4e-48
Query Start/End: Original strand, 1 - 125
Target Start/End: Complemental strand, 11630246 - 11630122
Alignment:
| Q |
1 |
agagagtgcagaaagactaattaatttttcaatgcagaaacataagtccttcccatcttcctctctgagtctcatgatgcctaaccttcttagttggctt |
100 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11630246 |
agagagtgcagaaagactgactaatttttcaatgcagaaacagaaatccttcccatcttcctctctgagtctcatgatgcctaaccttcttagttggctc |
11630147 |
T |
|
| Q |
101 |
agctcctataactgtcttattatca |
125 |
Q |
| |
|
||||||| ||| ||||||||||||| |
|
|
| T |
11630146 |
agctcctttaaatgtcttattatca |
11630122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 60; E-Value: 5e-26
Query Start/End: Original strand, 14 - 125
Target Start/End: Complemental strand, 11652541 - 11652430
Alignment:
| Q |
14 |
agactaattaatttttcaatgcagaaacataagtccttcccatcttcctctctgagtctcatgatgcctaaccttcttagttggcttagctcctataact |
113 |
Q |
| |
|
|||||| | |||||||| ||||| |||| || |||||||||||||||||||||||||||||||||||||| |||||||| ||||||| || || ||| | |
|
|
| T |
11652541 |
agactagtcaatttttcgatgcaccaacaaaattccttcccatcttcctctctgagtctcatgatgcctaatcttcttagctggcttaacttctgtaatt |
11652442 |
T |
|
| Q |
114 |
gtcttattatca |
125 |
Q |
| |
|
|||||||||||| |
|
|
| T |
11652441 |
gtcttattatca |
11652430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University