View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5848-38 (Length: 125)
Name: Solexa-NF5848-38
Description: NF5848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5848-38 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 72; Significance: 3e-33; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 72; E-Value: 3e-33
Query Start/End: Original strand, 7 - 82
Target Start/End: Original strand, 31808974 - 31809049
Alignment:
| Q |
7 |
agtttcacatcaatatcagtcttatatgctttagttgtggcaccaataaataagaaagtatagtcaactgaattat |
82 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
31808974 |
agtttcacatcaatatcagtcttatatgctttagttgtggcaccaataaataagagagtatagtcaactgaattat |
31809049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 79 - 115
Target Start/End: Complemental strand, 30260476 - 30260440
Alignment:
| Q |
79 |
ttatgttatgtgccttcattcgattcttttcttttct |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30260476 |
ttatgttatgtgccttcattcgattcttttcttttct |
30260440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University