View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5848-40 (Length: 122)
Name: Solexa-NF5848-40
Description: NF5848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5848-40 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 89; Significance: 2e-43; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 89; E-Value: 2e-43
Query Start/End: Original strand, 7 - 122
Target Start/End: Original strand, 11178405 - 11178523
Alignment:
| Q |
7 |
tatgtgacagtgtacgttc---atagaatttcaattttattaattaacatcataaaccatgctatatcttttctttattatcctacaatgcaacaaaaat |
103 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
11178405 |
tatgtgacaatgtacgttcttcatagaatttcaattttattaattaacatcataaaccatgatatatattttctttattatcctacaatgcaacaaaaat |
11178504 |
T |
 |
| Q |
104 |
tgcagtcaaatggtcctac |
122 |
Q |
| |
|
||||| ||||||||||||| |
|
|
| T |
11178505 |
tgcaggcaaatggtcctac |
11178523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University