View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5848-41 (Length: 121)
Name: Solexa-NF5848-41
Description: NF5848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5848-41 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 107; Significance: 4e-54; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 107; E-Value: 4e-54
Query Start/End: Original strand, 7 - 121
Target Start/End: Original strand, 11629433 - 11629547
Alignment:
| Q |
7 |
agatattgcagaggattacctgaagaagcttataagcagaaacttgttacaagtagcagagcgaacatctgatggaagagtcaaaactttgaggatccat |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11629433 |
agatattgcagaggattacctgaagaagcttataaacagaaacttgttacaagtagcagagcgaacatctgatggaagagtcaaaactttgaggatccat |
11629532 |
T |
|
| Q |
107 |
gaccttttgagggag |
121 |
Q |
| |
|
|| |||||||||||| |
|
|
| T |
11629533 |
gatcttttgagggag |
11629547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 58; E-Value: 7e-25
Query Start/End: Original strand, 7 - 108
Target Start/End: Original strand, 11651738 - 11651839
Alignment:
| Q |
7 |
agatattgcagaggattacctgaagaagcttataagcagaaacttgttacaagtagcagagcgaacatctgatggaagagtcaaaactttgaggatccat |
106 |
Q |
| |
|
|||| |||||||||||||||| || | ||||||| ||||||||| |||||||||||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
11651738 |
agatgttgcagaggattacctcaaagaacttataaacagaaacttactacaagtagcagagacaacatctgatggaagagtcaaaactttgagaatccat |
11651837 |
T |
|
| Q |
107 |
ga |
108 |
Q |
| |
|
|| |
|
|
| T |
11651838 |
ga |
11651839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University