View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5848-45 (Length: 105)
Name: Solexa-NF5848-45
Description: NF5848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5848-45 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 87; Significance: 3e-42; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 87; E-Value: 3e-42
Query Start/End: Original strand, 2 - 104
Target Start/End: Complemental strand, 4529531 - 4529429
Alignment:
| Q |
2 |
tttttgggcataagagaaacgtccttaacttgtaggaagatgatgatgtcagtgcaaactgtaatgcattatgagatgataaaaaacgtgatttgttttc |
101 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| | |
|
|
| T |
4529531 |
tttttgggcataagagaaatgttcttaacttgtaggaagatgatgatgtcagtgcaaactgtaatgcattatgagatgataaaaaacgtgttttgtttcc |
4529432 |
T |
|
| Q |
102 |
aat |
104 |
Q |
| |
|
||| |
|
|
| T |
4529431 |
aat |
4529429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.000000008
Query Start/End: Original strand, 17 - 55
Target Start/End: Complemental strand, 4519325 - 4519287
Alignment:
| Q |
17 |
gaaacgtccttaacttgtaggaagatgatgatgtcagtg |
55 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
4519325 |
gaaatgtccttaacttgtaggaagatgatgatgttagtg |
4519287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.00000003
Query Start/End: Original strand, 17 - 50
Target Start/End: Original strand, 4398377 - 4398410
Alignment:
| Q |
17 |
gaaacgtccttaacttgtaggaagatgatgatgt |
50 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
4398377 |
gaaatgtccttaacttgtaggaagatgatgatgt |
4398410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.000000008; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.000000008
Query Start/End: Original strand, 17 - 55
Target Start/End: Original strand, 18034204 - 18034242
Alignment:
| Q |
17 |
gaaacgtccttaacttgtaggaagatgatgatgtcagtg |
55 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
18034204 |
gaaatgtccttaacttgtaggaagatgatgatgttagtg |
18034242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000003
Query Start/End: Original strand, 17 - 50
Target Start/End: Complemental strand, 18046949 - 18046916
Alignment:
| Q |
17 |
gaaacgtccttaacttgtaggaagatgatgatgt |
50 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
18046949 |
gaaatgtccttaacttgtaggaagatgatgatgt |
18046916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University