View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5848-49 (Length: 99)
Name: Solexa-NF5848-49
Description: NF5848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5848-49 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 68; Significance: 6e-31; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 68; E-Value: 6e-31
Query Start/End: Original strand, 1 - 84
Target Start/End: Original strand, 31033623 - 31033706
Alignment:
| Q |
1 |
caccttcaccaccaagcttcacacagaaattacttgcttccaaggcccatagtacattgcgcaacaaaacaattccaggtcctc |
84 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31033623 |
caccttcaccaccaagcttcacgcacaaattacttgcttcaaagtcccatagtacattgcgcaacaaaacaattccaggtcctc |
31033706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University