View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5848-6 (Length: 159)
Name: Solexa-NF5848-6
Description: NF5848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5848-6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 122; Significance: 6e-63; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 122; E-Value: 6e-63
Query Start/End: Original strand, 7 - 157
Target Start/End: Original strand, 43093503 - 43093653
Alignment:
| Q |
7 |
agtttcaacctcaatgagaattgatgacctttgcagtgctaccaatttgaatagagatggtatagttgcatgatgtccatcataataagtagnnnnnnnc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
43093503 |
agtttcaacctcaatgagaattgatgacctttgcagtgctaccaatttgaatagagatggtatagttgcatgatgtccatcataataagtagaaaaaaac |
43093602 |
T |
 |
| Q |
107 |
tctcttataattaaacaatattctctgcagcggcaattaagaccctattct |
157 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43093603 |
tctcttgtaattaaacaatattctctgcagcggcaattaggaccctattct |
43093653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University