View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5848-61 (Length: 60)
Name: Solexa-NF5848-61
Description: NF5848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5848-61 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 58; Significance: 3e-25; HSPs: 6)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 58; E-Value: 3e-25
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 3564263 - 3564320
Alignment:
| Q |
1 |
ccgaggcttttgcagagttgaaggtgaaagaactaaaaaatggtaggttagctatgtt |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3564263 |
ccgaggcttttgcagagttgaaggtgaaagaactaaaaaatggtaggttagctatgtt |
3564320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 58; E-Value: 3e-25
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 3569911 - 3569968
Alignment:
| Q |
1 |
ccgaggcttttgcagagttgaaggtgaaagaactaaaaaatggtaggttagctatgtt |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3569911 |
ccgaggcttttgcagagttgaaggtgaaagaactaaaaaatggtaggttagctatgtt |
3569968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 44; E-Value: 7e-17
Query Start/End: Original strand, 3 - 58
Target Start/End: Original strand, 3572960 - 3573015
Alignment:
| Q |
3 |
gaggcttttgcagagttgaaggtgaaagaactaaaaaatggtaggttagctatgtt |
58 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
3572960 |
gaggcttttgcagagttaaaggtgaaagaactcaaaaatggaaggttagctatgtt |
3573015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 40; E-Value: 0.00000000000002
Query Start/End: Original strand, 3 - 58
Target Start/End: Original strand, 3576244 - 3576299
Alignment:
| Q |
3 |
gaggcttttgcagagttgaaggtgaaagaactaaaaaatggtaggttagctatgtt |
58 |
Q |
| |
|
||||||||||||||||| |||||||||||||| || ||||||||| |||||||||| |
|
|
| T |
3576244 |
gaggcttttgcagagttaaaggtgaaagaacttaagaatggtaggctagctatgtt |
3576299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 38; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 3584976 - 3584919
Alignment:
| Q |
1 |
ccgaggcttttgcagagttgaaggtgaaagaactaaaaaatggtaggttagctatgtt |
58 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| || |||||||||||||| ||||| |
|
|
| T |
3584976 |
ccgaggcttttgcagagttaaaggttaaagaactcaagaatggtaggttagcgatgtt |
3584919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 36; E-Value: 0.000000000004
Query Start/End: Original strand, 3 - 58
Target Start/End: Original strand, 3578100 - 3578155
Alignment:
| Q |
3 |
gaggcttttgcagagttgaaggtgaaagaactaaaaaatggtaggttagctatgtt |
58 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| || ||||| |||||||||||||| |
|
|
| T |
3578100 |
gaggcttttgcagagttaaaggttaaagaactcaagaatggcaggttagctatgtt |
3578155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University