View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5848-9 (Length: 218)
Name: Solexa-NF5848-9
Description: NF5848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5848-9 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 30994941 - 30994724
Alignment:
| Q |
1 |
gaaatgaatttcgtcaatcctcctaaaactatttgtgcatttagattgttgaacaaattatgcgggaaagaagaagcttaggcgtggtttgtggataatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30994941 |
gaaatgaatttcgtcaatcctcctaaaactatttgtgcatttagattgttgaacaaatgatgcgggaaagaagaagcttaggcgtggtttgtggataatt |
30994842 |
T |
 |
| Q |
101 |
tgacatgccgtaatttggttgatttgaaaggagagaaatggtagaatctttaaaaattatgttaaggaggtggatgagattctggagaatataaatgttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30994841 |
tgacatgccgtaatttggttgatttgaaaggagagaaatggtagaatctttaaaaattatgttaaggaggtggatgagattctggagaatataaatgttt |
30994742 |
T |
 |
| Q |
201 |
atcttggcattggagttt |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
30994741 |
atcttggcattggagttt |
30994724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 96 - 140
Target Start/End: Original strand, 11678297 - 11678341
Alignment:
| Q |
96 |
taatttgacatgccgtaatttggttgatttgaaaggagagaaatg |
140 |
Q |
| |
|
||||||| ||||||||||||||| ||||||| |||| |||||||| |
|
|
| T |
11678297 |
taatttggcatgccgtaatttgggtgatttggaaggtgagaaatg |
11678341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University