View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5851-1 (Length: 169)
Name: Solexa-NF5851-1
Description: NF5851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5851-1 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 6e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 6e-82
Query Start/End: Original strand, 8 - 169
Target Start/End: Original strand, 33443416 - 33443577
Alignment:
| Q |
8 |
agaagctcaggacatgtactccatggatgattttgttgagatggagaaaagggctatagtttctgttaatacaccgaaagaaggatacctgtccgatgta |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
33443416 |
agaagctcaggacatgtactccatggatgattttgttgagatggagaaaagggctatagtttctgttaatacaccgaaagaaggatacttgtccgatgta |
33443515 |
T |
|
| Q |
108 |
agtgggagggagctagtgccagttgaacaagattttgacctcggtgagacaagtaaggagat |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33443516 |
agtgggagggagctagtgccagttgaacaagattttgacctcggtgagacaaataaggagat |
33443577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University