View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5851-11 (Length: 100)
Name: Solexa-NF5851-11
Description: NF5851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5851-11 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 84; Significance: 2e-40; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 84; E-Value: 2e-40
Query Start/End: Original strand, 5 - 100
Target Start/End: Original strand, 4645028 - 4645123
Alignment:
| Q |
5 |
atcggtggctctcagtcattcacgccaccaccatgctgtcattatattagtcttgttttgcttatcatgtatcacgtctatctttttccctttgct |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4645028 |
atcggtggctctcagtccttcacgccaccaccatgctgtcataatattagtcttgttttgcttatcatgtatcgcgtctatctttttccctttgct |
4645123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 8 - 94
Target Start/End: Complemental strand, 32421128 - 32421045
Alignment:
| Q |
8 |
ggtggctctcagtcattcacgccaccaccatgctgtcattatattagtcttgttttgcttatcatgtatcacgtctatctttttccc |
94 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||| | ||| ||||||||| | |||||||||| || ||||||| ||||| |
|
|
| T |
32421128 |
ggtggctctcagtccatcacgccaccactgtgctgtcatga---tagccttgttttgatcatcatgtatcgcggctatcttcttccc |
32421045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University