View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5851-12 (Length: 92)
Name: Solexa-NF5851-12
Description: NF5851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5851-12 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 84; Significance: 2e-40; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 84; E-Value: 2e-40
Query Start/End: Original strand, 1 - 92
Target Start/End: Complemental strand, 12580932 - 12580841
Alignment:
| Q |
1 |
aatctaatatcatggacttgagatggagaggtattttcaacgtcatctttgtcctccttcagtagtatgatactgttacattgtacaagttt |
92 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
12580932 |
aatctaatatcatggacttgagatggagaggtattttcaacgtcatctttgtcctccttcagtagtatgataccgttacattgtgcaagttt |
12580841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 28; Significance: 0.0000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 28; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 33382099 - 33382138
Alignment:
| Q |
1 |
aatctaatatcatggacttgagatggagaggtattttcaa |
40 |
Q |
| |
|
|||||||||||||||||| ||||||| || |||||||||| |
|
|
| T |
33382099 |
aatctaatatcatggactcgagatggggaagtattttcaa |
33382138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University