View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5851-14 (Length: 73)
Name: Solexa-NF5851-14
Description: NF5851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5851-14 |
 | |
|
| [»] chr8 (3 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 73; Significance: 4e-34; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 73; E-Value: 4e-34
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 27984040 - 27983968
Alignment:
| Q |
1 |
ggaccttcacctaattcagggcactattttagctttgtgcgttctgctccagacaaatggtatttgatggatg |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27984040 |
ggaccttcacctaattcagggcactattttagctttgtgcgttctgctccagacaaatggtatttgatggatg |
27983968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 73; E-Value: 4e-34
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 28041342 - 28041270
Alignment:
| Q |
1 |
ggaccttcacctaattcagggcactattttagctttgtgcgttctgctccagacaaatggtatttgatggatg |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28041342 |
ggaccttcacctaattcagggcactattttagctttgtgcgttctgctccagacaaatggtatttgatggatg |
28041270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 65; E-Value: 3e-29
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 27238628 - 27238556
Alignment:
| Q |
1 |
ggaccttcacctaattcagggcactattttagctttgtgcgttctgctccagacaaatggtatttgatggatg |
73 |
Q |
| |
|
||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27238628 |
ggaccttcacctaattcagggcattatttttgctttgtgcgttctgctccagacaaatggtatttgatggatg |
27238556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University