View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5851-15 (Length: 70)
Name: Solexa-NF5851-15
Description: NF5851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5851-15 |
 |  |
|
| [»] scaffold0217 (1 HSPs) |
 |  |  |
|
| [»] scaffold0117 (1 HSPs) |
 |  |  |
|
| [»] scaffold0092 (1 HSPs) |
 |  |  |
|
| [»] scaffold0017 (1 HSPs) |
 |  |  |
|
| [»] scaffold0337 (1 HSPs) |
 |  |  |
|
| [»] scaffold0058 (1 HSPs) |
 |  |  |
|
| [»] scaffold0007 (1 HSPs) |
 |  |  |
|
| [»] scaffold0125 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0217 (Bit Score: 53; Significance: 4e-22; HSPs: 1)
Name: scaffold0217
Description:
Target: scaffold0217; HSP #1
Raw Score: 53; E-Value: 4e-22
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 27433 - 27369
Alignment:
| Q |
1 |
cgtcataggagtcatgctatgatacgtaatgggatggggatgtttttgtgttttgttttcctttg |
65 |
Q |
| |
|
||||||||| |||||||| |||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
27433 |
cgtcataggtgtcatgctctgatacgtaaagggatggggatgtttttgtgttttgttttcctttg |
27369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0117 (Bit Score: 53; Significance: 4e-22; HSPs: 1)
Name: scaffold0117
Description:
Target: scaffold0117; HSP #1
Raw Score: 53; E-Value: 4e-22
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 22884 - 22820
Alignment:
| Q |
1 |
cgtcataggagtcatgctatgatacgtaatgggatggggatgtttttgtgttttgttttcctttg |
65 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
22884 |
cgtcataggagtcatgctctgatacgtaacgggatggggatgtatttgtgttttgttttcctttg |
22820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0092 (Bit Score: 49; Significance: 9e-20; HSPs: 1)
Name: scaffold0092
Description:
Target: scaffold0092; HSP #1
Raw Score: 49; E-Value: 9e-20
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 39118 - 39182
Alignment:
| Q |
1 |
cgtcataggagtcatgctatgatacgtaatgggatggggatgtttttgtgttttgttttcctttg |
65 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
39118 |
cgtcatagaagtcatgctctgatacgtaatgggatggggatgtttatgtgtttttttttcctttg |
39182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 49; Significance: 9e-20; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 49; E-Value: 9e-20
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 19644381 - 19644317
Alignment:
| Q |
1 |
cgtcataggagtcatgctatgatacgtaatgggatggggatgtttttgtgttttgttttcctttg |
65 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| ||| |||||||||||||||||| |||| |
|
|
| T |
19644381 |
cgtcataggagtcatgctctgatacgtaatgggatggagatctttttgtgttttgttttcttttg |
19644317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 3e-16
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 45527229 - 45527171
Alignment:
| Q |
1 |
cgtcataggagtcatgctatgatacgtaatgggatggggatgtttttgtgttttgtttt |
59 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||| ||||||| ||||||||||||| |
|
|
| T |
45527229 |
cgtcataggagtcatgctctgatacgtaacgggatggagatgtttatgtgttttgtttt |
45527171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 39; E-Value: 0.00000000000008
Query Start/End: Original strand, 5 - 59
Target Start/End: Complemental strand, 19819005 - 19818951
Alignment:
| Q |
5 |
ataggagtcatgctatgatacgtaatgggatggggatgtttttgtgttttgtttt |
59 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||||| ||| ||||||||| |
|
|
| T |
19819005 |
ataggagtcatgctctgatacgtaacgggatggggatgtttatgttttttgtttt |
19818951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0017 (Bit Score: 47; Significance: 1e-18; HSPs: 1)
Name: scaffold0017
Description:
Target: scaffold0017; HSP #1
Raw Score: 47; E-Value: 1e-18
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 22369 - 22311
Alignment:
| Q |
1 |
cgtcataggagtcatgctatgatacgtaatgggatggggatgtttttgtgttttgtttt |
59 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
22369 |
cgtcataggagtcatgctctgatacgtaatgagatggggatgtttatgtgttttgtttt |
22311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 47; Significance: 1e-18; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 47; E-Value: 1e-18
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 3162020 - 3162078
Alignment:
| Q |
1 |
cgtcataggagtcatgctatgatacgtaatgggatggggatgtttttgtgttttgtttt |
59 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
3162020 |
cgtcataggagtcatgctctgatacgtaacgggatggggatgtttatgtgttttgtttt |
3162078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 19165403 - 19165467
Alignment:
| Q |
1 |
cgtcataggagtcatgctatgatacgtaatgggatggggatgtttttgtgttttgttttcctttg |
65 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||| ||||||| ||||||| |||||||||| |
|
|
| T |
19165403 |
cgtcataggagtcatgctctgatacgtaacgggatggagatgtttatgtgtttgtttttcctttg |
19165467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 6001855 - 6001818
Alignment:
| Q |
1 |
cgtcataggagtcatgctatgatacgtaatgggatggg |
38 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
6001855 |
cgtcataggagtcatgctctgatacgtaacgggatggg |
6001818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 47; Significance: 1e-18; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 47; E-Value: 1e-18
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 21190796 - 21190854
Alignment:
| Q |
1 |
cgtcataggagtcatgctatgatacgtaatgggatggggatgtttttgtgttttgtttt |
59 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
21190796 |
cgtcataggagtcatgctctgatacgtaataggatggggatgtttatgtgttttgtttt |
21190854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0337 (Bit Score: 45; Significance: 2e-17; HSPs: 1)
Name: scaffold0337
Description:
Target: scaffold0337; HSP #1
Raw Score: 45; E-Value: 2e-17
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 2591 - 2527
Alignment:
| Q |
1 |
cgtcataggagtcatgctatgatacgtaatgggatggggatgtttttgtgttttgttttcctttg |
65 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||| |||||||| ||||||||||||||||||| |
|
|
| T |
2591 |
cgtcataggagtcatgctctgatacgtaacaggatgaggatgtttatgtgttttgttttcctttg |
2527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 45; Significance: 2e-17; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 45; E-Value: 2e-17
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 24506782 - 24506846
Alignment:
| Q |
1 |
cgtcataggagtcatgctatgatacgtaatgggatggggatgtttttgtgttttgttttcctttg |
65 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||| ||| |||| ||||||||||||||||||| |
|
|
| T |
24506782 |
cgtcataggagtcatgctctgatacgtaacgggatgaggaagtttatgtgttttgttttcctttg |
24506846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 43; E-Value: 3e-16
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 18451599 - 18451541
Alignment:
| Q |
1 |
cgtcataggagtcatgctatgatacgtaatgggatggggatgtttttgtgttttgtttt |
59 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||| ||||||||| ||||||||||||| |
|
|
| T |
18451599 |
cgtcataggagtcatgctctgatacgtaacgggatagggatgtttgtgtgttttgtttt |
18451541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0058 (Bit Score: 43; Significance: 3e-16; HSPs: 1)
Name: scaffold0058
Description:
Target: scaffold0058; HSP #1
Raw Score: 43; E-Value: 3e-16
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 61075 - 61133
Alignment:
| Q |
1 |
cgtcataggagtcatgctatgatacgtaatgggatggggatgtttttgtgttttgtttt |
59 |
Q |
| |
|
|||||||||||||||||| |||||||||| | ||||||||||||| ||||||||||||| |
|
|
| T |
61075 |
cgtcataggagtcatgctctgatacgtaacgagatggggatgtttatgtgttttgtttt |
61133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 43; Significance: 3e-16; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 43; E-Value: 3e-16
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 33059215 - 33059157
Alignment:
| Q |
1 |
cgtcataggagtcatgctatgatacgtaatgggatggggatgtttttgtgttttgtttt |
59 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||||||||||||| | ||||||||||| |
|
|
| T |
33059215 |
cgtcatagaagtcatgctatgatacgtaacgggatggggatgtttatatgttttgtttt |
33059157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 18985842 - 18985900
Alignment:
| Q |
1 |
cgtcataggagtcatgctatgatacgtaatgggatggggatgtttttgtgttttgtttt |
59 |
Q |
| |
|
||||||| |||||||||| |||||| ||| |||||| |||||||| ||||||||||||| |
|
|
| T |
18985842 |
cgtcatatgagtcatgctctgatacataacgggatgaggatgtttatgtgttttgtttt |
18985900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 19000470 - 19000528
Alignment:
| Q |
1 |
cgtcataggagtcatgctatgatacgtaatgggatggggatgtttttgtgttttgtttt |
59 |
Q |
| |
|
||||||| |||||||||| |||||| ||| |||||| |||||||| ||||||||||||| |
|
|
| T |
19000470 |
cgtcatatgagtcatgctctgatacataacgggatgaggatgtttatgtgttttgtttt |
19000528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 33; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 10664035 - 10664095
Alignment:
| Q |
1 |
cgtcataggagtcatgctatgatacgtaatgggatggggatgtttttgtgttttgttttcc |
61 |
Q |
| |
|
|||||||||||||||||| |||||||||| || |||||||| || |||||||| |||||| |
|
|
| T |
10664035 |
cgtcataggagtcatgctctgatacgtaacggaatggggattcttatgtgttttattttcc |
10664095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 42; Significance: 0.000000000000001; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 21403255 - 21403194
Alignment:
| Q |
1 |
cgtcataggagtcatgctatgatacgtaatgggatggggatgtttttgtgttttgttttcct |
62 |
Q |
| |
|
||||||| |||||||||| |||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
21403255 |
cgtcataagagtcatgctctgatacgtaacaggatggggatgtttttgtgtttttttttcct |
21403194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 21419479 - 21419418
Alignment:
| Q |
1 |
cgtcataggagtcatgctatgatacgtaatgggatggggatgtttttgtgttttgttttcct |
62 |
Q |
| |
|
||||||| |||||||||| |||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
21419479 |
cgtcataagagtcatgctctgatacgtaacaggatggggatgtttttgtgtttttttttcct |
21419418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 38; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 38; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 83426 - 83483
Alignment:
| Q |
1 |
cgtcataggagtcatgctatgatacgtaatgggatggggatgtttttgtgttttgttt |
58 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||| ||| |||||||||||||||||| |
|
|
| T |
83426 |
cgtcataggagtcatgctctgatacgtaacaggatagggttgtttttgtgttttgttt |
83483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.00000000002; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 7464187 - 7464245
Alignment:
| Q |
1 |
cgtcataggagtcatgctatgatacgtaatgggatggggatgtttttgtgttttgtttt |
59 |
Q |
| |
|
|||||||||||||||||| | ||||||| ||||||||||||||| |||||||| |||| |
|
|
| T |
7464187 |
cgtcataggagtcatgctcagttacgtaacgggatggggatgtttatgtgttttatttt |
7464245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 38050019 - 38049978
Alignment:
| Q |
1 |
cgtcataggagtcatgctatgatacgtaatgggatggggatg |
42 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
38050019 |
cgtcataggagtcatgttttgatacgtaatgggatggggatg |
38049978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 22709443 - 22709503
Alignment:
| Q |
1 |
cgtcataggagtcatgctatgatacgtaatgggatggggatgtttttgtgttttgttttcc |
61 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||| |||| || |||||||| |||||| |
|
|
| T |
22709443 |
cgtcataggagtcatgctctgatacgtaacgggatgtggattcttatgtgttttattttcc |
22709503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000001; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 3 - 65
Target Start/End: Complemental strand, 14476330 - 14476267
Alignment:
| Q |
3 |
tcataggagtcatgctatgatacgtaatgggatgggg-atgtttttgtgttttgttttcctttg |
65 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||||||| || ||| ||||||||||||||||||| |
|
|
| T |
14476330 |
tcataggagtcaggctctgatacgtaacaggatgggggatatttatgtgttttgttttcctttg |
14476267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.000000005
Query Start/End: Original strand, 3 - 61
Target Start/End: Original strand, 14354739 - 14354797
Alignment:
| Q |
3 |
tcataggagtcatgctatgatacgtaatgggatggggatgtttttgtgttttgttttcc |
61 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||||| || |||||||| |||||| |
|
|
| T |
14354739 |
tcataggagtcatgctctgatacgtaacaggatggggattcttatgtgttttattttcc |
14354797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0125 (Bit Score: 29; Significance: 0.00000008; HSPs: 1)
Name: scaffold0125
Description:
Target: scaffold0125; HSP #1
Raw Score: 29; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 7620 - 7660
Alignment:
| Q |
1 |
cgtcataggagtcatgctatgatacgtaatgggatggggat |
41 |
Q |
| |
|
|||||||||||||||||| |||||||||| | ||||||||| |
|
|
| T |
7620 |
cgtcataggagtcatgctctgatacgtaacgagatggggat |
7660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University