View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5851-2 (Length: 141)
Name: Solexa-NF5851-2
Description: NF5851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5851-2 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 123; Significance: 1e-63; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 123; E-Value: 1e-63
Query Start/End: Original strand, 19 - 141
Target Start/End: Complemental strand, 10036429 - 10036307
Alignment:
| Q |
19 |
atataggtcatgttttcttccattgcccatttgctgttcaggcgtggaactcggcaaggttatggcagcaggtgcagctgtccactccacggcaatagca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10036429 |
atataggtcatgttttcttccattgcccatttgctgttcaggcgtggaactcggcaaggttatggcagcaggtgcagctgtccactccacggcaatagca |
10036330 |
T |
|
| Q |
119 |
gcagaagccattttctctctttt |
141 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
10036329 |
gcagaagccattttctctctttt |
10036307 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 119; E-Value: 3e-61
Query Start/End: Original strand, 19 - 141
Target Start/End: Complemental strand, 10096809 - 10096687
Alignment:
| Q |
19 |
atataggtcatgttttcttccattgcccatttgctgttcaggcgtggaactcggcaaggttatggcagcaggtgcagctgtccactccacggcaatagca |
118 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10096809 |
atatagatcatgttttcttccattgcccatttgctgttcaggcgtggaactcggcaaggttatggcagcaggtgcagctgtccactccacggcaatagca |
10096710 |
T |
|
| Q |
119 |
gcagaagccattttctctctttt |
141 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
10096709 |
gcagaagccattttctctctttt |
10096687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University