View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5851-6 (Length: 129)
Name: Solexa-NF5851-6
Description: NF5851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5851-6 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 109; Significance: 3e-55; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 109; E-Value: 3e-55
Query Start/End: Original strand, 1 - 129
Target Start/End: Original strand, 37442964 - 37443092
Alignment:
| Q |
1 |
tgagaagaattgtgcaccatggttctgctaaaaacttttcaacctacatcaacacttttaatcatgaagctaagaatcaaatgtcctcgccgtctattct |
100 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||| |
|
|
| T |
37442964 |
tgagatgaattgtgcaccatggttctgctaaaaacttttcaacctacatcaacacttttaatcatgaagctaaaaatcaaatgtcctcgccgtctagtct |
37443063 |
T |
|
| Q |
101 |
tgtatattaatttctctctcgtgattatg |
129 |
Q |
| |
|
||||||||||||||||| |||| |||||| |
|
|
| T |
37443064 |
tgtatattaatttctctatcgtaattatg |
37443092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 53; E-Value: 8e-22
Query Start/End: Original strand, 36 - 88
Target Start/End: Original strand, 34941322 - 34941374
Alignment:
| Q |
36 |
ttttcaacctacatcaacacttttaatcatgaagctaagaatcaaatgtcctc |
88 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34941322 |
ttttcaacctacatcaacacttttaatcatgaagctaagaatcaaatgtcctc |
34941374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University