View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5851-7 (Length: 116)
Name: Solexa-NF5851-7
Description: NF5851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5851-7 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 94; Significance: 2e-46; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 94; E-Value: 2e-46
Query Start/End: Original strand, 7 - 116
Target Start/End: Original strand, 10036138 - 10036247
Alignment:
| Q |
7 |
atttcttgctgttgtcgcgatcccattcgtccatgatgtgccgagcacgatccacaacatgggctcatacttcatgttcattctgccaaagcttcaagtt |
106 |
Q |
| |
|
|||||||||||||||||| |||||||| ||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10036138 |
atttcttgctgttgtcgcaatcccatttgtccatgatgtgccgagcacggtccacaacctgggctcatacttcatgttcattctgccaaagcttcaagtt |
10036237 |
T |
|
| Q |
107 |
gcgatgcttc |
116 |
Q |
| |
|
|||||||||| |
|
|
| T |
10036238 |
gcgatgcttc |
10036247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 83; E-Value: 8e-40
Query Start/End: Original strand, 7 - 116
Target Start/End: Original strand, 10096517 - 10096627
Alignment:
| Q |
7 |
atttcttgctgttgtcgcgatcccattcgtccatgatgtgccgagcacgatccacaacatgggctcatacttcatgttcattctgccaaagcttc-aagt |
105 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
10096517 |
atttcttgttgttgtcgcaatcccattcgtccatgatgtgccgagcacggtccacaacctgggctcatacttcatgttcattctgccaaagcttcaaagt |
10096616 |
T |
|
| Q |
106 |
tgcgatgcttc |
116 |
Q |
| |
|
||| ||||||| |
|
|
| T |
10096617 |
tgcaatgcttc |
10096627 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University