View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5852-2 (Length: 209)
Name: Solexa-NF5852-2
Description: NF5852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5852-2 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 8 - 209
Target Start/End: Complemental strand, 6189203 - 6189002
Alignment:
| Q |
8 |
gtttgtgtttctcctccctcgttacccgagtggtccctgctttattttatggtcaacaatcttgaactcnnnnnnnagtgttaactagtatgctggaagg |
107 |
Q |
| |
|
||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||| | |
|
|
| T |
6189203 |
gtttgtgtttctcgtctctcgttacccgagtggtccctgctttattttatggtcaacaatcttgaactctttttttagtgttaactagtatgccggaaag |
6189104 |
T |
|
| Q |
108 |
caatgtagagattaatacttcgtgttaggtaggatcacaataggcgacaaaactctctctcaagaggtttgacacagttgcatataaagtcttttatcat |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6189103 |
caatgtagagattaatacttcgtgttaggtaggatcacaataggcgacaaaaccctctctcaagaggtttgacacagttgcatataaagtcttttatcat |
6189004 |
T |
|
| Q |
208 |
ct |
209 |
Q |
| |
|
|| |
|
|
| T |
6189003 |
ct |
6189002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University