View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5852-23 (Length: 127)
Name: Solexa-NF5852-23
Description: NF5852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5852-23 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 114; Significance: 3e-58; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 114; E-Value: 3e-58
Query Start/End: Original strand, 6 - 127
Target Start/End: Complemental strand, 13677009 - 13676888
Alignment:
| Q |
6 |
catgaagtacacccctagcataggtaaatcttcatcaagtttagttttttgaagtatcgggcttcattatttgaagcgtttatagttaaagtttaagaga |
105 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13677009 |
catgaagtacacccctagcataggtaaaccttcatcaagtctagttttttgaagtatcgggcttcattatttgaagcgtttatagttaaagtttaagaga |
13676910 |
T |
 |
| Q |
106 |
atttcttatcccatcccaatgt |
127 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
13676909 |
atttcttatcccatcccaatgt |
13676888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University