View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5852-32 (Length: 121)
Name: Solexa-NF5852-32
Description: NF5852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5852-32 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 78; Significance: 9e-37; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 78; E-Value: 9e-37
Query Start/End: Original strand, 8 - 89
Target Start/End: Original strand, 51766426 - 51766507
Alignment:
| Q |
8 |
atgaagaggaggccagctataagacctgatgtggttgataggtaacactgagatgctttcaacagcttctccccgtcatttg |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
51766426 |
atgaagaggaggccagctataagacctgatgtggttgataggtaacactgagatgctttcaacagcttctccccgtcgtttg |
51766507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 7e-25
Query Start/End: Original strand, 8 - 121
Target Start/End: Original strand, 51753659 - 51753772
Alignment:
| Q |
8 |
atgaagaggaggccagctataagacctgatgtggttgataggtaacactgagatgctttcaacagcttctccccgtcatttgcattaaaaagttgcataa |
107 |
Q |
| |
|
|||||||||||||| |||||| |||||||||| ||||||| ||||||||| |||||||||||||||||||| || || || || ||||||||| ||||| |
|
|
| T |
51753659 |
atgaagaggaggcctgctataggacctgatgttgttgataagtaacactgtgatgctttcaacagcttctctccatctttaacactaaaaagttccataa |
51753758 |
T |
|
| Q |
108 |
atactttctctact |
121 |
Q |
| |
|
| ||||| |||||| |
|
|
| T |
51753759 |
acactttttctact |
51753772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University