View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5852-36 (Length: 108)
Name: Solexa-NF5852-36
Description: NF5852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5852-36 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 98; Significance: 9e-49; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 98; E-Value: 9e-49
Query Start/End: Original strand, 7 - 108
Target Start/End: Complemental strand, 40866619 - 40866518
Alignment:
| Q |
7 |
aagaaaaagatacaagctcatgagaagaaaaaatatgttatcaaacatgtcttcttttgttatatgagcatatatataagctgtaatttcaaaattctgt |
106 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40866619 |
aagaaaaatatacaagctcatgagaagaaaaaatatgttatcaaacatgtcttcttttgttatatgagcatatatataagctgtaatttcaaaattctgt |
40866520 |
T |
 |
| Q |
107 |
tt |
108 |
Q |
| |
|
|| |
|
|
| T |
40866519 |
tt |
40866518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University