View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5852-43 (Length: 61)
Name: Solexa-NF5852-43
Description: NF5852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5852-43 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 44; Significance: 7e-17; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 44; E-Value: 7e-17
Query Start/End: Original strand, 6 - 57
Target Start/End: Complemental strand, 18367928 - 18367877
Alignment:
| Q |
6 |
catgtaattcaaactctctcacttttctctttaattacatgaccctcctttg |
57 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
18367928 |
catgtaattcaatctctctcacttttctctttaattacatgaccctcttttg |
18367877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 44; Significance: 7e-17; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 44; E-Value: 7e-17
Query Start/End: Original strand, 6 - 57
Target Start/End: Complemental strand, 23261182 - 23261131
Alignment:
| Q |
6 |
catgtaattcaaactctctcacttttctctttaattacatgaccctcctttg |
57 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
23261182 |
catgtaattcaatctctctcacttttctctttaattacatgaccctcttttg |
23261131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.00000000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.00000000000002
Query Start/End: Original strand, 6 - 57
Target Start/End: Complemental strand, 35762654 - 35762603
Alignment:
| Q |
6 |
catgtaattcaaactctctcacttttctctttaattacatgaccctcctttg |
57 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
35762654 |
catgtaattcaatctctctcacttttctctttaatttcatgaccctcttttg |
35762603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University