View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: Solexa-NF5852-43 (Length: 61)

Name: Solexa-NF5852-43
Description: NF5852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] Solexa-NF5852-43
Solexa-NF5852-43
[»] chr7 (1 HSPs)
chr7 (6-57)||(18367877-18367928)
[»] chr6 (1 HSPs)
chr6 (6-57)||(23261131-23261182)
[»] chr1 (1 HSPs)
chr1 (6-57)||(35762603-35762654)


Alignment Details
Target: chr7 (Bit Score: 44; Significance: 7e-17; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 44; E-Value: 7e-17
Query Start/End: Original strand, 6 - 57
Target Start/End: Complemental strand, 18367928 - 18367877
Alignment:
6 catgtaattcaaactctctcacttttctctttaattacatgaccctcctttg 57  Q
    |||||||||||| |||||||||||||||||||||||||||||||||| ||||    
18367928 catgtaattcaatctctctcacttttctctttaattacatgaccctcttttg 18367877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 44; Significance: 7e-17; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 44; E-Value: 7e-17
Query Start/End: Original strand, 6 - 57
Target Start/End: Complemental strand, 23261182 - 23261131
Alignment:
6 catgtaattcaaactctctcacttttctctttaattacatgaccctcctttg 57  Q
    |||||||||||| |||||||||||||||||||||||||||||||||| ||||    
23261182 catgtaattcaatctctctcacttttctctttaattacatgaccctcttttg 23261131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 40; Significance: 0.00000000000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.00000000000002
Query Start/End: Original strand, 6 - 57
Target Start/End: Complemental strand, 35762654 - 35762603
Alignment:
6 catgtaattcaaactctctcacttttctctttaattacatgaccctcctttg 57  Q
    |||||||||||| ||||||||||||||||||||||| |||||||||| ||||    
35762654 catgtaattcaatctctctcacttttctctttaatttcatgaccctcttttg 35762603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University