View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5852-6 (Length: 160)
Name: Solexa-NF5852-6
Description: NF5852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5852-6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 143; Significance: 2e-75; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 143; E-Value: 2e-75
Query Start/End: Original strand, 8 - 158
Target Start/End: Original strand, 50336716 - 50336866
Alignment:
| Q |
8 |
aaacatacacagaaacataacaaaacattaacacataggaagaggagatagagaatgagagcaataaattcgcatgttgtcttaattgatcttcactgca |
107 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50336716 |
aaacatacagagaaacataacaaaacgttaacacataggaagaggagatagagaatgagagcaataaattcgcatgttgtcttaattgatcttcactgca |
50336815 |
T |
 |
| Q |
108 |
cctcatggcaaaggaacaacaaccttaacaataaacaactgttttcttcat |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50336816 |
cctcatggcaaaggaacaacaaccttaacaataaacaactgttttcttcat |
50336866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University