View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5853-10 (Length: 152)
Name: Solexa-NF5853-10
Description: NF5853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5853-10 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 137; Significance: 7e-72; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 137; E-Value: 7e-72
Query Start/End: Original strand, 12 - 152
Target Start/End: Original strand, 42655634 - 42655774
Alignment:
| Q |
12 |
agataagtggactacaacgattttgacaaacgctacgaaaataacactgccactatgattttgccaaactctattccactttcaggaaatctgagtttag |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
42655634 |
agataagtggactacaacgattttgacaaacgctacgaaaataacactgccactatgattttgccaaactctattccactttcaggaaaactgagtttag |
42655733 |
T |
|
| Q |
112 |
aaattaccttcatgaccaaactgtttgacttggtattctct |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42655734 |
aaattaccttcatgaccaaactgtttgacttggtattctct |
42655774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University