View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5853-2 (Length: 230)
Name: Solexa-NF5853-2
Description: NF5853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5853-2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 7 - 226
Target Start/End: Original strand, 30370041 - 30370257
Alignment:
| Q |
7 |
attctgaacatgacgtttggatgaaatcgaggagatagaactaatnnnnnnnnnnngagatatatagaagtagttataaggtacaaaatgcatgattatt |
106 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| ||||||| ||||||||||||||||||| |||||||||||||||||||| ||| |
|
|
| T |
30370041 |
attctgaacatgacatttggatgaaatcgaggagataaaactaataaaaaaaa---gagatatatagaagtagttgtaaggtacaaaatgcatgataatt |
30370137 |
T |
|
| Q |
107 |
gtttacataaagaacaaaatattacttcaccattatagcttatttagttctataaacatttcattgatcaattaataatctccatcttatcgttgaataa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30370138 |
gtttacataaagaacaaaatattacttcaccattatagcttatttagttctataaacatttcattgatcaattaataatctccatcttatcgttgaataa |
30370237 |
T |
|
| Q |
207 |
tagaactaaaatggagcctc |
226 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
30370238 |
tagaactaaaatggagcctc |
30370257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University