View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: Solexa-NF5853-27 (Length: 127)

Name: Solexa-NF5853-27
Description: NF5853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] Solexa-NF5853-27
Solexa-NF5853-27
[»] chr4 (2 HSPs)
chr4 (8-127)||(36722239-36722358)
chr4 (61-118)||(48667365-48667422)
[»] chr2 (1 HSPs)
chr2 (73-127)||(2425761-2425815)


Alignment Details
Target: chr4 (Bit Score: 116; Significance: 2e-59; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 116; E-Value: 2e-59
Query Start/End: Original strand, 8 - 127
Target Start/End: Original strand, 36722239 - 36722358
Alignment:
8 agttcttcatccacatattggttatcatcttcttggtagtcttcgccggtttaatgtccggactcaccttaggtctcatgtctctcagtctcgttgatct 107  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
36722239 agttcttcatccacatattggttatcatcttcttggtagtcttcgctggtttaatgtccggactcaccttaggtctcatgtctctcagtctcgttgatct 36722338  T
108 tgaagttcttgctaagtctg 127  Q
    ||||||||||||||||||||    
36722339 tgaagttcttgctaagtctg 36722358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000004
Query Start/End: Original strand, 61 - 118
Target Start/End: Original strand, 48667365 - 48667422
Alignment:
61 atgtccggactcaccttaggtctcatgtctctcagtctcgttgatcttgaagttcttg 118  Q
    |||||||| |||||  | ||||||||||||||||||||||| || |||||| ||||||    
48667365 atgtccggtctcactcttggtctcatgtctctcagtctcgtcgaccttgaaattcttg 48667422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 35; Significance: 0.00000000004; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000004
Query Start/End: Original strand, 73 - 127
Target Start/End: Complemental strand, 2425815 - 2425761
Alignment:
73 accttaggtctcatgtctctcagtctcgttgatcttgaagttcttgctaagtctg 127  Q
    |||||||| ||||||||||| ||||| ||||||||||| ||||||||||| ||||    
2425815 accttaggcctcatgtctctgagtcttgttgatcttgaggttcttgctaaatctg 2425761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University