View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5853-31 (Length: 125)
Name: Solexa-NF5853-31
Description: NF5853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5853-31 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 48; Significance: 7e-19; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 48; E-Value: 7e-19
Query Start/End: Original strand, 74 - 125
Target Start/End: Original strand, 39479534 - 39479585
Alignment:
| Q |
74 |
ggttcataaaggaagtatgtacttcattaatatcaatgattgctgctgttat |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
39479534 |
ggttcataaaggaagtatgtacttcattaatattaatgattgctgctgttat |
39479585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000004
Query Start/End: Original strand, 8 - 37
Target Start/End: Original strand, 39479468 - 39479497
Alignment:
| Q |
8 |
ctattgtcttgccctgccgtgggcatgtcg |
37 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
39479468 |
ctattgtcttgccctgccgtgggcatgtcg |
39479497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University