View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5853-32 (Length: 125)
Name: Solexa-NF5853-32
Description: NF5853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5853-32 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 117; Significance: 5e-60; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 117; E-Value: 5e-60
Query Start/End: Original strand, 5 - 125
Target Start/End: Complemental strand, 34750283 - 34750163
Alignment:
| Q |
5 |
acagtgtgatggcaccaatgctcaaattcttaaacagaaccaattcatttttcttcattgatgcatacccatatttcccatggtcacaggaccccaacac |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34750283 |
acagtgtgatggcaccaatgctcaaattcttaaacagaaccaattcatttttcttcattgatgcatacccatatttcccatggtcacaggaccccaacaa |
34750184 |
T |
|
| Q |
105 |
tattcccctagactatgctct |
125 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
34750183 |
tattcccctagactatgctct |
34750163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 66; Significance: 1e-29; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 66; E-Value: 1e-29
Query Start/End: Original strand, 8 - 116
Target Start/End: Complemental strand, 26593624 - 26593515
Alignment:
| Q |
8 |
gtgtgatggcaccaatgctcaaattcttaaacagaaccaattcatttttcttcattgatgcatacccatatttcccatggtcacaggaccc-caacacta |
106 |
Q |
| |
|
||||||| |||||||||||||||||||| ||| ||||| |||||||||| |||||||||||||||||||||||||||||||||||||| ||||| || |
|
|
| T |
26593624 |
gtgtgatagcaccaatgctcaaattctttgacatgaccaactcatttttctctattgatgcatacccatatttcccatggtcacaggaccctcaacagta |
26593525 |
T |
|
| Q |
107 |
ttcccctaga |
116 |
Q |
| |
|
|||||||||| |
|
|
| T |
26593524 |
ttcccctaga |
26593515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University