View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5853-33 (Length: 123)
Name: Solexa-NF5853-33
Description: NF5853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5853-33 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 106; Significance: 2e-53; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 106; E-Value: 2e-53
Query Start/End: Original strand, 7 - 120
Target Start/End: Original strand, 26843065 - 26843178
Alignment:
| Q |
7 |
aaatacctgatctagatgttaaaaaatttgctcaagttatgttagatgagattctctacgatacatatatactttcaacttattgattttgacatgtttt |
106 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26843065 |
aaatacctgttctagatgttaaaaaatttgctcaagttatgttagatgagattctctacgatacatatatactttcaacttattgattttgacatgtttt |
26843164 |
T |
|
| Q |
107 |
ttgttatacctttt |
120 |
Q |
| |
|
|||||||| ||||| |
|
|
| T |
26843165 |
ttgttataactttt |
26843178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University