View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5853-43 (Length: 101)
Name: Solexa-NF5853-43
Description: NF5853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5853-43 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 45; Significance: 3e-17; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 45; E-Value: 3e-17
Query Start/End: Original strand, 5 - 61
Target Start/End: Complemental strand, 42936709 - 42936653
Alignment:
| Q |
5 |
cacagacccctgttgcctttatctttgatcgttacttgacagatcacttaattattt |
61 |
Q |
| |
|
|||| ||| |||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42936709 |
cacacaccactgttgcctttatcttcgatcgttacttgacagatcacttaattattt |
42936653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University