View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5853-47 (Length: 88)
Name: Solexa-NF5853-47
Description: NF5853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5853-47 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 87; Significance: 2e-42; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 87; E-Value: 2e-42
Query Start/End: Original strand, 2 - 88
Target Start/End: Complemental strand, 34688429 - 34688343
Alignment:
| Q |
2 |
gtgacaagagcacgatcataataccaggatggcaatccatgagctatttttcggatgtgtcgaacatatgttggtttcttgaggcag |
88 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34688429 |
gtgacaagagcacgatcataataccaggatggcaatccatgagctatttttcggatgtgtcgaacatatgttggtttcttgaggcag |
34688343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000003
Query Start/End: Original strand, 4 - 53
Target Start/End: Complemental strand, 43614605 - 43614556
Alignment:
| Q |
4 |
gacaagagcacgatcataataccaggatggcaatccatgagctatttttc |
53 |
Q |
| |
|
||||||| ||| || |||||||||||||||||||| ||||| |||||||| |
|
|
| T |
43614605 |
gacaagaccacaataataataccaggatggcaatctatgagttatttttc |
43614556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University