View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5854-10 (Length: 70)
Name: Solexa-NF5854-10
Description: NF5854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5854-10 |
 | |
|
| [»] scaffold0813 (1 HSPs) |
| |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: scaffold0813 (Bit Score: 64; Significance: 1e-28; HSPs: 1)
Name: scaffold0813
Description:
Target: scaffold0813; HSP #1
Raw Score: 64; E-Value: 1e-28
Query Start/End: Original strand, 7 - 70
Target Start/End: Complemental strand, 3857 - 3794
Alignment:
| Q |
7 |
aaactcatccaacacgatcttcatctccataggaagtaggtggaaactgtccatctgtctatgc |
70 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3857 |
aaactcatccaacacgatcttcatctccataggaagtaggtggaaactgtccatctgtctatgc |
3794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 64; Significance: 1e-28; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 64; E-Value: 1e-28
Query Start/End: Original strand, 7 - 70
Target Start/End: Original strand, 6618125 - 6618188
Alignment:
| Q |
7 |
aaactcatccaacacgatcttcatctccataggaagtaggtggaaactgtccatctgtctatgc |
70 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6618125 |
aaactcatccaacacgatcttcatctccataggaagtaggtggaaactgtccatctgtctatgc |
6618188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 11 - 58
Target Start/End: Original strand, 6526573 - 6526620
Alignment:
| Q |
11 |
tcatccaacacgatcttcatctccataggaagtaggtggaaactgtcc |
58 |
Q |
| |
|
|||| ||||| |||||||||||||| ||| ||| |||||||||||||| |
|
|
| T |
6526573 |
tcatacaacatgatcttcatctccacaggcagtgggtggaaactgtcc |
6526620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University