View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5854-3 (Length: 158)
Name: Solexa-NF5854-3
Description: NF5854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5854-3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 116; Significance: 2e-59; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 116; E-Value: 2e-59
Query Start/End: Original strand, 17 - 148
Target Start/End: Original strand, 32829360 - 32829491
Alignment:
| Q |
17 |
ggtaaaagatggaaaaaacgaaaccctagaaattgattgggacaagaatcattgtcggagttaaggtttgattgaaggggagttatgtgtgtttattttt |
116 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32829360 |
ggtaaaaggtggaaaaaacgaaaccctagaaattgattgggacaagaatcattgtcggagttaaggtttgattgaagggaagttatgtgtgtttattttt |
32829459 |
T |
|
| Q |
117 |
tgtgtgtgaagattggatttctgggttctgtg |
148 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |
|
|
| T |
32829460 |
tgtgtgtgaagattgcgtttctgggttctgtg |
32829491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University