View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5854-7 (Length: 127)
Name: Solexa-NF5854-7
Description: NF5854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5854-7 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
| [»] chr8 (3 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 52; Significance: 3e-21; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 52; E-Value: 3e-21
Query Start/End: Original strand, 72 - 127
Target Start/End: Complemental strand, 8377614 - 8377559
Alignment:
| Q |
72 |
tggagcgccctttcccttaccttaacaacagcagctcttaagatatccaccaacag |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
8377614 |
tggagcgccctttcccttaccttaacaacagcagctcttaagatttccaccaacag |
8377559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 48; Significance: 7e-19; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 48; E-Value: 7e-19
Query Start/End: Original strand, 72 - 127
Target Start/End: Original strand, 7094187 - 7094242
Alignment:
| Q |
72 |
tggagcgccctttcccttaccttaacaacagcagctcttaagatatccaccaacag |
127 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
7094187 |
tggagcgccctttcccttaccttaacaatagcagctcttaagatttccaccaacag |
7094242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 48; E-Value: 7e-19
Query Start/End: Original strand, 72 - 127
Target Start/End: Original strand, 7097920 - 7097975
Alignment:
| Q |
72 |
tggagcgccctttcccttaccttaacaacagcagctcttaagatatccaccaacag |
127 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
7097920 |
tggagcgccctttcccttaccttaacaatagcagctcttaagatttccaccaacag |
7097975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 28; E-Value: 0.0000006
Query Start/End: Original strand, 72 - 107
Target Start/End: Original strand, 454143 - 454178
Alignment:
| Q |
72 |
tggagcgccctttcccttaccttaacaacagcagct |
107 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||| |
|
|
| T |
454143 |
tggagcgccctttcccgtaccttaacaacagtagct |
454178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 28; Significance: 0.0000006; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 28; E-Value: 0.0000006
Query Start/End: Original strand, 72 - 99
Target Start/End: Original strand, 19632970 - 19632997
Alignment:
| Q |
72 |
tggagcgccctttcccttaccttaacaa |
99 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
19632970 |
tggagcgccctttcccttaccttaacaa |
19632997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 28; Significance: 0.0000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 28; E-Value: 0.0000006
Query Start/End: Original strand, 72 - 99
Target Start/End: Complemental strand, 19215573 - 19215546
Alignment:
| Q |
72 |
tggagcgccctttcccttaccttaacaa |
99 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
19215573 |
tggagcgccctttcccttaccttaacaa |
19215546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University