View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5855-10 (Length: 142)
Name: Solexa-NF5855-10
Description: NF5855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5855-10 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 105; Significance: 8e-53; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 105; E-Value: 8e-53
Query Start/End: Original strand, 1 - 142
Target Start/End: Original strand, 31257194 - 31257345
Alignment:
| Q |
1 |
agatgaatatgcaaatcgagattggatcctctcctttcccctcgttgtctctttctccctccttcatcaagttatgtctatctctcacttgatat----- |
95 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31257194 |
agatgaatgtgcaaatcgagattggatcctctcctttcccctcattgtctctttctccctccttcatcaagttatgtctatctctcacttgatatccccc |
31257293 |
T |
 |
| Q |
96 |
-----cccccctctctctcaaatccatgaacgtgagctcaaaaatttgtgac |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
31257294 |
ccccccccccctctctctcaaatccatgaacgtgagctcataaatttgtgac |
31257345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University