View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5855-21 (Length: 130)
Name: Solexa-NF5855-21
Description: NF5855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5855-21 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 99; Significance: 3e-49; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 99; E-Value: 3e-49
Query Start/End: Original strand, 8 - 130
Target Start/End: Original strand, 8991382 - 8991504
Alignment:
| Q |
8 |
gagtttaaccggaggtaagttagtgggggtaactccgtcttagccaaagtatctctgttttatgctagccctcacttgtttattgatgtatcatgtttta |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||| |||||||||||||||||||||||| | || |
|
|
| T |
8991382 |
gagtttaaccggaggtaagttagtgggggtaactccgtcttagccaaagtatccccgttttatgctagctctcacttgtttattgatgtatcatcatgta |
8991481 |
T |
|
| Q |
108 |
tttgtatcttgatttcaaataaa |
130 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
8991482 |
tttgtatcttgatttcaaataaa |
8991504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 99; E-Value: 3e-49
Query Start/End: Original strand, 8 - 130
Target Start/End: Original strand, 9015829 - 9015951
Alignment:
| Q |
8 |
gagtttaaccggaggtaagttagtgggggtaactccgtcttagccaaagtatctctgttttatgctagccctcacttgtttattgatgtatcatgtttta |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||| |||||||||||||||||||||||| | || |
|
|
| T |
9015829 |
gagtttaaccggaggtaagttagtgggggtaactccgtcttagccaaagtatccccgttttatgctagctctcacttgtttattgatgtatcatcatgta |
9015928 |
T |
|
| Q |
108 |
tttgtatcttgatttcaaataaa |
130 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
9015929 |
tttgtatcttgatttcaaataaa |
9015951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University