View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: Solexa-NF5855-27 (Length: 127)

Name: Solexa-NF5855-27
Description: NF5855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] Solexa-NF5855-27
Solexa-NF5855-27
[»] chr8 (1 HSPs)
chr8 (8-127)||(1969561-1969680)
[»] chr4 (1 HSPs)
chr4 (82-114)||(5890573-5890605)


Alignment Details
Target: chr8 (Bit Score: 120; Significance: 8e-62; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 120; E-Value: 8e-62
Query Start/End: Original strand, 8 - 127
Target Start/End: Complemental strand, 1969680 - 1969561
Alignment:
8 attcattctagttattaatgaaaaatgattatacaattcaacaacaacctctcttggtagtgtaatataaatctatgattatcatctgctttaaaatggc 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1969680 attcattctagttattaatgaaaaatgattatacaattcaacaacaacctctcttggtagtgtaatataaatctatgattatcatctgctttaaaatggc 1969581  T
108 tatgattactttcattgatg 127  Q
    ||||||||||||||||||||    
1969580 tatgattactttcattgatg 1969561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 82 - 114
Target Start/End: Original strand, 5890573 - 5890605
Alignment:
82 atgattatcatctgctttaaaatggctatgatt 114  Q
    |||||||||||||||||||||||| ||||||||    
5890573 atgattatcatctgctttaaaatgactatgatt 5890605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University