View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5855-36 (Length: 117)
Name: Solexa-NF5855-36
Description: NF5855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5855-36 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 106; Significance: 2e-53; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 106; E-Value: 2e-53
Query Start/End: Original strand, 8 - 113
Target Start/End: Original strand, 4513125 - 4513230
Alignment:
| Q |
8 |
aaaacacggctagtagctttatgttgaaaatttcggcttccttatcacttcatatggatgataacgaagaatgactcttctcattcgttttttattcatt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4513125 |
aaaacacggctagtagctttatgttgaaaatttcggcttccttatcacttcatatggatgataacgaagaatgactcttctcattcgttttttattcatt |
4513224 |
T |
 |
| Q |
108 |
gtccgt |
113 |
Q |
| |
|
|||||| |
|
|
| T |
4513225 |
gtccgt |
4513230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University