View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5855-37 (Length: 113)
Name: Solexa-NF5855-37
Description: NF5855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5855-37 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 94; Significance: 2e-46; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 94; E-Value: 2e-46
Query Start/End: Original strand, 8 - 109
Target Start/End: Original strand, 10761184 - 10761285
Alignment:
| Q |
8 |
agggtttgctcattgtgctctacgggcccaggcctcgtgcgagtgggttgggtttattgacgtggatgaattcttcaacgtaaagatacaaggaggcttg |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
10761184 |
agggtttgctcattgtgctctacgggcccagtcctcgtgcgagtgggttgggtttattgacgtggatgagttcttcaacgtaaagatacaaggaggcttg |
10761283 |
T |
|
| Q |
108 |
aa |
109 |
Q |
| |
|
|| |
|
|
| T |
10761284 |
aa |
10761285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University