View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5855-40 (Length: 111)
Name: Solexa-NF5855-40
Description: NF5855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5855-40 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 107; Significance: 4e-54; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 107; E-Value: 4e-54
Query Start/End: Original strand, 1 - 111
Target Start/End: Original strand, 42519071 - 42519181
Alignment:
| Q |
1 |
acagaggaaacaaagttcttataatccatcatggcctcagagttacaggttaagtccttttttcaatccccctaggtttcagtgcacctgtgtgtgtcac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42519071 |
acagaggaaacaaagttcttataatccatcatggcctcagagttacaggttaagtccttttttcaatccccctagatttcagtgcacctgtgtgtgtcac |
42519170 |
T |
 |
| Q |
101 |
ttcacgtacct |
111 |
Q |
| |
|
||||||||||| |
|
|
| T |
42519171 |
ttcacgtacct |
42519181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University