View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5855-41 (Length: 111)
Name: Solexa-NF5855-41
Description: NF5855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5855-41 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 78; Significance: 8e-37; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 78; E-Value: 8e-37
Query Start/End: Original strand, 8 - 111
Target Start/End: Original strand, 31320787 - 31320887
Alignment:
| Q |
8 |
attagtatgcaaagcttcatgtttaggttgagttttttcctcaggaaccaagtaggattatttaactatccagcatcagaatgaaagttcagactaaacc |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
31320787 |
attagtatgcaaagcttcatgtttaggttgagtttaatcctcaggaaccaagtaggattatttaactatccagcat---aatgaaagttcaaactaaacc |
31320883 |
T |
 |
| Q |
108 |
tata |
111 |
Q |
| |
|
|||| |
|
|
| T |
31320884 |
tata |
31320887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University