View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5855-45 (Length: 106)
Name: Solexa-NF5855-45
Description: NF5855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5855-45 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 92; Significance: 3e-45; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 92; E-Value: 3e-45
Query Start/End: Original strand, 2 - 105
Target Start/End: Original strand, 38569312 - 38569415
Alignment:
| Q |
2 |
ttgtggaggagcagagacaagaaagcatgagtttcgaagatgttcggtttgcggtgttgtgaattattgttcacgcgcttgtcaagcgcttgattggaag |
101 |
Q |
| |
|
||||||| || | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38569312 |
ttgtggaagacctgagacaagaaagcatgagtttcgaagatgttcggtttgcggtgttgtgaattattgttcacgcgcttgtcaagcgcttgattggaag |
38569411 |
T |
|
| Q |
102 |
tttc |
105 |
Q |
| |
|
|||| |
|
|
| T |
38569412 |
tttc |
38569415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 54; Significance: 2e-22; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 54; E-Value: 2e-22
Query Start/End: Original strand, 24 - 105
Target Start/End: Complemental strand, 34683331 - 34683250
Alignment:
| Q |
24 |
aagcatgagtttcgaagatgttcggtttgcggtgttgtgaattattgttcacgcgcttgtcaagcgcttgattggaagtttc |
105 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||| || |||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
34683331 |
aagcatgagtttcgaaggtgttcggtttgtggtgcggttaattattgctcacgtgcttgtcaagcgcttgattggaagtttc |
34683250 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University