View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: Solexa-NF5855-45 (Length: 106)

Name: Solexa-NF5855-45
Description: NF5855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] Solexa-NF5855-45
Solexa-NF5855-45
[»] chr3 (1 HSPs)
chr3 (2-105)||(38569312-38569415)
[»] chr8 (1 HSPs)
chr8 (24-105)||(34683250-34683331)


Alignment Details
Target: chr3 (Bit Score: 92; Significance: 3e-45; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 92; E-Value: 3e-45
Query Start/End: Original strand, 2 - 105
Target Start/End: Original strand, 38569312 - 38569415
Alignment:
2 ttgtggaggagcagagacaagaaagcatgagtttcgaagatgttcggtttgcggtgttgtgaattattgttcacgcgcttgtcaagcgcttgattggaag 101  Q
    ||||||| || | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38569312 ttgtggaagacctgagacaagaaagcatgagtttcgaagatgttcggtttgcggtgttgtgaattattgttcacgcgcttgtcaagcgcttgattggaag 38569411  T
102 tttc 105  Q
    ||||    
38569412 tttc 38569415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 54; Significance: 2e-22; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 54; E-Value: 2e-22
Query Start/End: Original strand, 24 - 105
Target Start/End: Complemental strand, 34683331 - 34683250
Alignment:
24 aagcatgagtttcgaagatgttcggtttgcggtgttgtgaattattgttcacgcgcttgtcaagcgcttgattggaagtttc 105  Q
    ||||||||||||||||| ||||||||||| ||||  || |||||||| ||||| ||||||||||||||||||||||||||||    
34683331 aagcatgagtttcgaaggtgttcggtttgtggtgcggttaattattgctcacgtgcttgtcaagcgcttgattggaagtttc 34683250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University