View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5855-46 (Length: 104)
Name: Solexa-NF5855-46
Description: NF5855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5855-46 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 98; Significance: 8e-49; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 98; E-Value: 8e-49
Query Start/End: Original strand, 7 - 104
Target Start/End: Original strand, 1800321 - 1800418
Alignment:
| Q |
7 |
agatggaaatcttaaactgttgattaaaaacaccaatgaattgaaaatccttgtcagtatttgcgagcaacttttagaatgtgagaggtgagcttttc |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1800321 |
agatggaaatcttaaactgttgattaaaaacaccaatgaattgaaaatccttgtcagtatttgcgagcaacttttagaatgtgagaggtgagcttttc |
1800418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 49; Significance: 1e-19; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 49; E-Value: 1e-19
Query Start/End: Original strand, 8 - 103
Target Start/End: Complemental strand, 25730158 - 25730063
Alignment:
| Q |
8 |
gatggaaatcttaaa-ctgttgattaaaaacaccaatgaattgaaaatccttgtcagtatttgcgagcaacttttagaatgtgagaggtgagctttt |
103 |
Q |
| |
|
|||| |||||||||| || |||||||||||||| |||||||||||| ||||||| |||||||| |||||| |||||||||||||||||||| |||| |
|
|
| T |
25730158 |
gatgaaaatcttaaagcttttgattaaaaacactaatgaattgaaa-tccttgttagtatttgtgagcaatctttagaatgtgagaggtgagttttt |
25730063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University