View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: Solexa-NF5855-52 (Length: 90)

Name: Solexa-NF5855-52
Description: NF5855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] Solexa-NF5855-52
Solexa-NF5855-52
[»] chr8 (2 HSPs)
chr8 (8-89)||(6350515-6350596)
chr8 (11-46)||(6287079-6287114)


Alignment Details
Target: chr8 (Bit Score: 66; Significance: 9e-30; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 66; E-Value: 9e-30
Query Start/End: Original strand, 8 - 89
Target Start/End: Complemental strand, 6350596 - 6350515
Alignment:
8 ctcatatggttcaaatatggtatcaattgagtttttcctcaattctctctgatttctcgcacgacttttttcttcatctcac 89  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||| | ||||||    
6350596 ctcatatggttcaaatatggtatcaactgagtttttcctcaattctctctgatttctcgcacaacttttttctccttctcac 6350515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 28; E-Value: 0.0000004
Query Start/End: Original strand, 11 - 46
Target Start/End: Complemental strand, 6287114 - 6287079
Alignment:
11 atatggttcaaatatggtatcaattgagtttttcct 46  Q
    |||||||||||||||||||||| || ||||||||||    
6287114 atatggttcaaatatggtatcagtttagtttttcct 6287079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University