View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5855-52 (Length: 90)
Name: Solexa-NF5855-52
Description: NF5855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5855-52 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 66; Significance: 9e-30; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 66; E-Value: 9e-30
Query Start/End: Original strand, 8 - 89
Target Start/End: Complemental strand, 6350596 - 6350515
Alignment:
| Q |
8 |
ctcatatggttcaaatatggtatcaattgagtttttcctcaattctctctgatttctcgcacgacttttttcttcatctcac |
89 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||| | |||||| |
|
|
| T |
6350596 |
ctcatatggttcaaatatggtatcaactgagtttttcctcaattctctctgatttctcgcacaacttttttctccttctcac |
6350515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 28; E-Value: 0.0000004
Query Start/End: Original strand, 11 - 46
Target Start/End: Complemental strand, 6287114 - 6287079
Alignment:
| Q |
11 |
atatggttcaaatatggtatcaattgagtttttcct |
46 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||| |
|
|
| T |
6287114 |
atatggttcaaatatggtatcagtttagtttttcct |
6287079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University