View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5855-58 (Length: 56)
Name: Solexa-NF5855-58
Description: NF5855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5855-58 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 51; Significance: 4e-21; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 51; E-Value: 4e-21
Query Start/End: Original strand, 6 - 56
Target Start/End: Complemental strand, 3137649 - 3137599
Alignment:
| Q |
6 |
caaattgtccattttaggggaccatgtggctccctttatgccaaaccctat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3137649 |
caaattgtccattttaggggaccatgtggctccctttatgccaaaccctat |
3137599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University