View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5855-6 (Length: 194)
Name: Solexa-NF5855-6
Description: NF5855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5855-6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 7e-91; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 7e-91
Query Start/End: Original strand, 8 - 192
Target Start/End: Complemental strand, 27065660 - 27065476
Alignment:
| Q |
8 |
ttatcatcctttcttgtttctacgatagaattgttatcaacatcgattatgatgtcgttcatcggaagaagaacacggtctgttctgatttctggctcag |
107 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27065660 |
ttatcatcctgtcttgtttctacgatagaattgttatcaacatcgattatgatgtcgttcgtcggaagaagaacacggtctgttctgatttctggctcag |
27065561 |
T |
|
| Q |
108 |
ggagttcttctgattctgcagagctatcatgtgaagaatcaaatggagaagatgatgaagtctttggtgttcttctttttggtct |
192 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27065560 |
ggagttcttctgattctgcagagctatcaagtggagaatcaaatggagaagatgatgaagtctttggtgttcttctttttggtct |
27065476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 169; E-Value: 7e-91
Query Start/End: Original strand, 8 - 192
Target Start/End: Original strand, 27212653 - 27212837
Alignment:
| Q |
8 |
ttatcatcctttcttgtttctacgatagaattgttatcaacatcgattatgatgtcgttcatcggaagaagaacacggtctgttctgatttctggctcag |
107 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27212653 |
ttatcatcctgtcttgtttctacgatagaattgttatcaacatcgattatgatgtcgttcgtcggaagaagaacacggtctgttctgatttctggctcag |
27212752 |
T |
|
| Q |
108 |
ggagttcttctgattctgcagagctatcatgtgaagaatcaaatggagaagatgatgaagtctttggtgttcttctttttggtct |
192 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27212753 |
ggagttcttctgattctgcagagctatcaagtggagaatcaaatggagaagatgatgaagtctttggtgttcttctttttggtct |
27212837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University