View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5856-10 (Length: 130)
Name: Solexa-NF5856-10
Description: NF5856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5856-10 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 106; Significance: 4e-54; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 106; E-Value: 4e-54
Query Start/End: Original strand, 1 - 130
Target Start/End: Original strand, 47782358 - 47782487
Alignment:
| Q |
1 |
agaagtgagaagagttttgtacagtagtttattcgccatgatgcggcatggttcatgtttctatcccrtcgctgcttctaargaagagactccccatttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||| ||||||||||||| |||||| |||||| |||| |
|
|
| T |
47782358 |
agaagtgagaagagttttgtacagtagtttattcgccatgatgtggcatggttcgtgtttctatcccgtcgctgcttctaaagaagaggctccccttttt |
47782457 |
T |
|
| Q |
101 |
gtaagatgaagaaagaatatgtacagtatg |
130 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |
|
|
| T |
47782458 |
gtaagatgaagaaagaatgtgtacagtatg |
47782487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University