View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5856-13 (Length: 106)
Name: Solexa-NF5856-13
Description: NF5856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5856-13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 98; Significance: 9e-49; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 98; E-Value: 9e-49
Query Start/End: Original strand, 8 - 105
Target Start/End: Complemental strand, 5159502 - 5159405
Alignment:
| Q |
8 |
ctttgcaagataaagtttagataagggaaaacataccatggagaattatcagttaaatttgacagattaaacacaggagtacttcttatgtgtctctg |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5159502 |
ctttgcaagataaagtttagataagggaaaacataccatggagaattatcagttaaatttgacagattaaacacaggagtacttcttatgtgtctctg |
5159405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 28; E-Value: 0.0000005
Query Start/End: Original strand, 50 - 85
Target Start/End: Complemental strand, 5162805 - 5162770
Alignment:
| Q |
50 |
gaattatcagttaaatttgacagattaaacacagga |
85 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||||| |
|
|
| T |
5162805 |
gaattatcagttcaatttgacagattaaatacagga |
5162770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University